Stem-loop sequence gma-MIR164k

AccessionMI0021689 (change log)
DescriptionGlycine max miR164k stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164k
(37 sentences)

Stem-loop
   a    c           ca            -c    ---uu    uuc     cu 
5'  gguc uguuggagaag  gggcacgugcaa  ucag     cuag   uagcu  a
    |||| |||||||||||  ||||||||||||  ||||     ||||   |||||  u
3'  uuag acaaccucuuc  cucgugcacguu  aguc     gauc   gucga  u
   -    c           cc            uu    uauuu    -uc     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 46912450-46912558 [-]
intergenic
Database links

Mature sequence gma-miR164k

Accession MIMAT0024895
Sequence

10 - 

uggagaagcagggcacgugca

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).