Stem-loop sequence gma-MIR164j

AccessionMI0021688 (change log)
DescriptionGlycine max miR164j stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164j
(37 sentences)

Stem-loop
   a    uu          c             c  -uc   au c 
5'  gguc  gcuggagaag agggcacgugcaa au   cug  g u
    ||||  |||||||||| ||||||||||||| ||   |||  |  
3'  uuag  cgaccuuuuc ucucgugcacguu ua   gac  c u
   -    uu          c             u  uuc   cu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 48278744-48278831 [+]
intergenic
Database links

Mature sequence gma-miR164j

Accession MIMAT0024894
Sequence

10 - 

uggagaagcagggcacgugca

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).