Stem-loop sequence gma-MIR164h

AccessionMI0021686 (change log)
DescriptionGlycine max miR164h stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164h
(37 sentences)

Stem-loop
   u   g  a     a    ca         caau    c      aacacacggcgugugagcucggagaucaaucaca 
5'  ugu ca gaugg gaag  gggcacgug    acua cucaug                                  u
    ||| || ||||| ||||  |||||||||    |||| ||||||                                  u
3'  aca gu cuacc cuuc  cccguguac    ugau gaguau                                  c
   a   -  a     c    cc         uucc    u      ccuagagagacccaaccaguuuacuucgucuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 49456787-49456944 [-]
intergenic
Database links

Mature sequence gma-miR164h

Accession MIMAT0024892
Sequence

11 - 

uggagaagcagggcacgugca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).