Stem-loop sequence gma-MIR164g

AccessionMI0021685 (change log)
DescriptionGlycine max miR164g stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164g
(37 sentences)

Stem-loop
   gc   u           ca             --uc  -u    ucu 
5'   ucc uguuggagaag  gggcacgugcaag    uc  uggc   c
     ||| |||||||||||  |||||||||||||    ||  ||||    
3'   ggg acaaccucuuc  cucgugcacguuu    ag  accg   a
   -u   c           cc             ccca  uc    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 44895293-44895384 [+]
intergenic
Database links

Mature sequence gma-miR164g

Accession MIMAT0024891
Sequence

10 - 

uggagaagcagggcacgugca

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).