Stem-loop sequence gma-MIR164f

AccessionMI0021684 (change log)
DescriptionGlycine max miR164f stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164f
(37 sentences)

Stem-loop
   a    uu          c             cu  ccucucacucagagac 
5'  gguc  gcuggagaag agggcacgugcaa  uc                u
    ||||  |||||||||| |||||||||||||  ||                 
3'  uuag  cgaccuuuuc ucucgugcacguu  ag                c
   -    uu          c             uu  ucgaacuuguucguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 43533079-43533181 [+]
intergenic
Database links

Mature sequence gma-miR164f

Accession MIMAT0024890
Sequence

10 - 

uggagaagcagggcacgugca

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).