Stem-loop sequence gma-MIR164e

AccessionMI0021683 (change log)
DescriptionGlycine max miR164e stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164e
(37 sentences)

Stem-loop
   -   acu           ca            --cuc  -uc   u  c 
5'  gcu   uguuggagaag  gggcacgugcaa     uc   ggc cu u
    |||   |||||||||||  ||||||||||||     ||   ||| || u
3'  cgg   acaaccucuuc  cucgugcacguu     ag   ccg ga u
   u   --c           cc            uccca  uua   c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 1535426-1535520 [+]
intergenic
Database links

Mature sequence gma-miR164e

Accession MIMAT0024889
Sequence

10 - 

uggagaagcagggcacgugca

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).