Stem-loop sequence gma-MIR160f

AccessionMI0021682 (change log)
DescriptionGlycine max miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

20 open access papers mention gma-MIR160f
(59 sentences)

Stem-loop
   u    u      c       cu            uagacc       a 
5'  acau gugugc uggcucc  guaugccauuug      ccaucac a
    |||| |||||| |||||||  ||||||||||||      |||||||  
3'  ugug cguacg acugagg  uaugcgguaaac      gguagug u
   -    u      u       ag            uauucc       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 4750208-4750304 [-]
intergenic
Database links

Mature sequence gma-miR160f

Accession MIMAT0024888
Sequence

10 - 

ugccuggcucccuguaugcca

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).