Stem-loop sequence gma-MIR156ab

AccessionMI0021681
DescriptionGlycine max miR156ab stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
   ucaaac  aa            -      c  u  ug  c    augaugggaaaccucugcugcuaauucguggauaccucugguuccguaacaa 
5'       ac  gcuggagcucuc ucacuu aa ua  ag ggau                                                    c
         ||  |||||||||||| |||||| || ||  || ||||                                                     
3'       ug  uggccucgaggg agugaa uu au  uu ucua                                                    a
   ----ua  gg            u      -  u  gu  u    guuccauuauugaaguagaggguuaaguacguuugggaacugaagcuugcau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr7: 5376509-5376696 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR156ab
gma-MIR156abchr7: 5376509-5376696 [+]
gma-MIR159bchr7: 5386107-5386292 [-]

Mature sequence gma-miR156ab

Accession MIMAT0024887
Sequence

160 - 

auuuaagugaugggagcuccg

 - 180

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).