Stem-loop sequence gma-MIR156y

AccessionMI0021678
DescriptionGlycine max miR156y stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   uaa  ga         -             a     uac    uu a    uau 
5'    gg  ggugacaga agagagugagcac cauag   uuuc  g auga   a
      ||  ||||||||| ||||||||||||| |||||   ||||  | ||||   a
3'    cu  ccacugucu ucucucauucgug guauu   gaag  c uacu   g
   -ca  ac         a             c     ---    uu g    uug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr17: 38431869-38431974 [-]
intergenic

Mature sequence gma-miR156y

Accession MIMAT0024884
Sequence

10 - 

ugacagaagagagugagcac

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).