Stem-loop sequence gma-MIR156x

AccessionMI0021677
DescriptionGlycine max miR156x stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ggguaa  ga         -             a      auu   uu g    uau 
5'       ga  ggugacaga agagagugagcac cauggu   uuc  g auga   a
         ||  ||||||||| ||||||||||||| ||||||   |||  | ||||   a
3'       cu  ccacugucu ucucuuacucgug guauca   aag  c uacu   g
   -uacua  ac         a             c      ---   uu g    uua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr14: 9431596-9431707 [+]
intergenic

Mature sequence gma-miR156x

Accession MIMAT0024883
Sequence

13 - 

ugacagaagagagugagcac

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).