Stem-loop sequence gma-MIR156w

AccessionMI0021676 (change log)
DescriptionGlycine max miR156w stem-loop
Gene family MIPF0000008; MIR156
   cuaag  a         -                    auu   uu   c  ug 
5'      gg gaugacaga agagagugagcacacauggu   uuc  gca ga  a
        || ||||||||| ||||||||||||||||||||   |||  ||| ||  c
3'      cc cuacugucu ucucucauucguguguaucg   aag  cgu cu  g
   cacua  -         a                    ---   uu   a  ua 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 4047089-4047194 [+]
Database links

Mature sequence gma-miR156w

Accession MIMAT0024882

11 - 


 - 30

Get sequence
Evidence experimental; Illumina [1]


PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).