Stem-loop sequence gma-MIR156v

AccessionMI0021675 (change log)
DescriptionGlycine max miR156v stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156v
(162 sentences)

   uaag  a         -                    acu   uu   a  ua 
5'     gg ggugacaga agagagugagcacacauaau   uuc  gua ga  a
       || ||||||||| ||||||||||||||||||||   |||  ||| ||  a
3'     cc ccacugucu ucucucacucguguguauug   aag  cgu cu  g
   acca  -         a                    ---   uu   a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 4306348-4306451 [+]
Database links

Mature sequence gma-miR156v

Accession MIMAT0024881

10 - 


 - 29

Get sequence
Evidence experimental; Illumina [1]


PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).