Stem-loop sequence gma-MIR156u

AccessionMI0021674 (change log)
DescriptionGlycine max miR156u stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ga a            -     -        a    a  gga         a 
5'   g gaggcugacaga agaga gugagcac uacu gu   gauuguaug g
     | |||||||||||| ||||| |||||||| |||| ||   |||||||||  
3'   c cuucgacugucu ucucu cacucgug gugg cg   uuaacauac g
   -a c            a     u        c    g  ---         g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 38792955-38793054 [+]
intergenic
Database links

Mature sequence gma-miR156u

Accession MIMAT0024880
Sequence

10 - 

ugacagaagagagugagcac

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).