Stem-loop sequence ppe-MIR171e

AccessionMI0021626 (change log)
DescriptionPrunus persica miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ppe-MIR171e
(16 sentences)

Stem-loop
   a  ggc   u        ca   c     c a       a    aag 
5'  gu   acg gauauugg  cgg ucaau a aaagcag gcuc   c
    ||   ||| ||||||||  ||| ||||| | ||||||| ||||   a
3'  ca   ugc cuauaacc  gcc aguua u uuucguc cgag   c
   c  aau   c        ag   a     u c       a    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 21899742-21899838 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR171e
ppe-MIR171echrG3: 21899742-21899838 [-]
ppe-MIR171achrG3: 21899734-21899848 [+]
Database links

Mature sequence ppe-miR171e

Accession MIMAT0027289
Sequence

67 - 

uuauugaaccggaccaauauc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1