Stem-loop sequence osa-MIR6253

AccessionMI0021603 (change log)
DescriptionOryza sativa miR6253 stem-loop
Literature search

3 open access papers mention osa-MIR6253
(5 sentences)

Stem-loop
   aua  -   u            gca      uu    uu 
5'    uc aau agaggaaagugg   guuggg  aagc  a
      || ||| ||||||||||||   ||||||  ||||  u
3'    ag uua ucuccuuuuacu   caaccu  uuug  u
   ucc  a   c            -aa      cu    uc 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 25019014-25019092 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR6253
osa-MIR6253Chr7: 25019014-25019092 [-]
osa-MIR6255Chr7: 25018786-25018870 [-]
Database links

Mature sequence osa-miR6253

Accession MIMAT0024876
Sequence

11 - 

gaggaaagugggcaguuggguu

 - 32

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).