Stem-loop sequence osa-MIR6251

AccessionMI0021601 (change log)
DescriptionOryza sativa miR6251 stem-loop
Literature search

1 open access papers mention osa-MIR6251
(2 sentences)

Stem-loop
   -                     a       -  a       u  a   ggucaaucucgcagaaagcccacugcaauccaaaucuucuucacgauuguuccuauucac 
5'  uggcaugccauguguagccac uuguaag gg guccuug gc cau                                                            c
    ||||||||||||||||||||| ||||||| || ||||||| || |||                                                             
3'  accguacgguguacaucggug gacguuc cc cagggac cg gua                                                            a
   c                     c       a  -       c  -   ccuacaaucguugucguugucucccuuuaccacccgccaguaagcucuucugcccacuaa 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 15792337-15792550 [+]
intergenic
Database links

Mature sequence osa-miR6251

Accession MIMAT0024874
Sequence

11 - 

uguguagccacauuguaaggg

 - 31

Get sequence
Deep sequencing61 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).