Stem-loop sequence osa-MIR6250

AccessionMI0021600 (change log)
DescriptionOryza sativa miR6250 stem-loop
Literature search

4 open access papers mention osa-MIR6250
(16 sentences)

Stem-loop
   uguuuuu      uu  -     a  -       cuugu      ua      -g       auau 
5'        uuucuu  ug guuga uc guccucu     ucuugu  aggugg  ggcacca    a
          ||||||  || ||||| || |||||||     ||||||  ||||||  |||||||    u
3'        aaagaa  gc cagcu ag uagggga     agagcg  ucuacc  ccguggu    c
   cuuugcu      cu  g     -  a       -----      uc      ga       acca 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 28264615-28264740 [+]
intergenic
Database links

Mature sequence osa-miR6250

Accession MIMAT0024873
Sequence

95 - 

ggggauagaucgacgcgucaag

 - 116

Get sequence
Deep sequencing23 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).