Stem-loop sequence osa-MIR5512b

AccessionMI0021599 (change log)
DescriptionOryza sativa miR5512b stem-loop
Gene family MIPF0001478; MIR5512
Literature search

1 open access papers mention osa-MIR5512b
(2 sentences)

Stem-loop
   a          --                                  acuuuagacaauccaaucu 
5'  uguauuuuuu  uagcauuaccauauccuauuuggcaaugaauuuc                   u
    ||||||||||  ||||||||||||||||||||||||||||||||||                    
3'  acauaaaaaa  aucguaaugguauaggauaaaccguuacuuaaag                   a
   a          aa                                  uauaugaucucauacaaga 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 18386979-18387110 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5512b
osa-MIR5512bChr4: 18386979-18387110 [-]
osa-MIR5512aChr4: 18386976-18387112 [+]
Database links

Mature sequence osa-miR5512b

Accession MIMAT0024872
Sequence

102 - 

uaggauaugguaaugcuaaaa

 - 122

Get sequence
Deep sequencing33 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).