Stem-loop sequence osa-MIR6248

AccessionMI0021596 (change log)
DescriptionOryza sativa miR6248 stem-loop
Literature search

2 open access papers mention osa-MIR6248
(6 sentences)

Stem-loop
   ga   aa  c              c            ac           a 
5'   uaa  ug uacuaccucuaucc caaauauaaggg  uuugccuaugu a
     |||  || |||||||||||||| ||||||||||||  |||||||||||  
3'   auu  ac augauggagguagg guuuauauuccu  aaacggauaca u
   gg   cg  u              a            -a           u 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 32572985-32573087 [-]
intergenic
Database links

Mature sequence osa-miR6248

Accession MIMAT0024869
Sequence

73 - 

uauuugaggauggagguagua

 - 93

Get sequence
Deep sequencing51 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).