Stem-loop sequence osa-MIR6246

AccessionMI0021594 (change log)
DescriptionOryza sativa miR6246 stem-loop
Literature search

1 open access papers mention osa-MIR6246
(1 sentences)

Stem-loop
   -          -     -  u     g       a      u 
5'  aacccucaga uuggg ga uuccu ccggagg agcuuu u
    |||||||||| ||||| || ||||| ||||||| |||||| g
3'  uugggagucu gaccu cu aagga gguuucc ucgagg g
   u          u     u  c     g       g      a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 1625438-1625521 [+]
intergenic
Database links

Mature sequence osa-miR6246

Accession MIMAT0024867
Sequence

11 - 

uuggggauuuccugccggaggaa

 - 33

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).