Stem-loop sequence osa-MIR1440b

AccessionMI0021593 (change log)
DescriptionOryza sativa miR1440b stem-loop
Gene family MIPF0001531; MIR1440
Literature search

4 open access papers mention osa-MIR1440b
(9 sentences)

Stem-loop
   a                           c           a                                 cuuuccauucaaacaaaag 
5'  aaugccagugcucaaauaccacucucc aaauuuucauu ccaaauaccauccgggcccacaugucagccuca                   u
    ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||                   g
3'  uuacgguuacgaguuuauggugagagg uuuaaagguaa gguuuauggugggcccggguguacagucggagu                   a
   -                           a           g                                 aggucgugucccagggugu 
Get sequence
Deep sequencing
201 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 5980506-5980693 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1440b
osa-MIR1440aChr9: 5980506-5980694 [-]
osa-MIR1440bChr9: 5980506-5980693 [+]
Database links

Mature sequence osa-miR1440b

Accession MIMAT0024866
Sequence

158 - 

uuuaggagagugguauuugag

 - 178

Get sequence
Deep sequencing71 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).