Stem-loop sequence mmu-mir-6244

AccessionMI0021591 (change log)
Symbol MGI:Mir6244
DescriptionMus musculus miR-6244 stem-loop
Literature search

1 open access papers mention mmu-mir-6244
(2 sentences)

Stem-loop
   ---   -cu    aa   - au   -  caua  a          gaa       gua   ag 
5'    agg   cugg  ggu g  cga cu    gc ugggggcgug   uuaucgg   agg  u
      |||   ||||  ||| |  ||| ||    || ||||||||||   |||||||   |||   
3'    ucc   gacc  cca c  guu ga    cg accuucguau   gauagcc   ucu  a
   gga   uuc    --   u cg   c  uacc  -          acc       --g   gc 
Get sequence
Deep sequencing
18 reads, 2.68e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 52115623-52115739 [+]
antisense
ENSMUST00000165519 ; Zc3h12c-201; exon 6
Database links

Mature sequence mmu-miR-6244

Accession MIMAT0024864
Sequence

31 - 

gggggcguggaauuaucgggu

 - 51

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1