Stem-loop sequence mmu-mir-6240

AccessionMI0021587 (change log)
Symbol MGI:Mir6240
DescriptionMus musculus miR-6240 stem-loop
Literature search

4 open access papers mention mmu-mir-6240
(11 sentences)

Stem-loop
   uu    aaa   --aaac  -aaaa   -c  a     --c  -    gcc    g     g 
5'   gaga   aca      ca     acc  ca agcau   gc gaag   cacg cgggu u
     ||||   |||      ||     |||  || |||||   || ||||   |||| |||||  
3'   cucu   ugu      gu     ugg  gu ucgug   cg cuuu   gugu gcuca u
   uu    cag   aaagaa  guaac   aa  c     acc  u    --a    a     g 
Get sequence
Deep sequencing
46354 reads, 643 reads per million, 109 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 114851948-114852064 [+]
intergenic
Database links

Mature sequence mmu-miR-6240

Accession MIMAT0024861
Sequence

26 - 

ccaaagcaucgcgaaggcccacggcg

 - 51

Get sequence
Deep sequencing9160 reads, 102 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1