Stem-loop sequence mmu-mir-6239

AccessionMI0021586 (change log)
Symbol MGI:Mir6239
DescriptionMus musculus miR-6239 stem-loop
Literature search

1 open access papers mention mmu-mir-6239
(4 sentences)

Stem-loop
   -----uaa   g   -au   ucu   c       --u         au      gu 
5'         agc gug   guu   ggc cugggug   uagcguugg  cacuca  g
           ||| |||   |||   ||| |||||||   |||||||||  ||||||   
3'         uug uac   cgg   ucg ggcucac   guugcgauc  gugggu  u
   gacaagcc   g   cuu   -ug   u       uag         --      gu 
Get sequence
Deep sequencing
4818 reads, 1.12 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 117953743-117953847 [-]
antisense
OTTMUST00000043485 ; Gpc6-001; intron 7
OTTMUST00000083121 ; Gpc6-002; intron 8
OTTMUST00000083123 ; Gpc6-004; intron 8
ENSMUST00000078849 ; Gpc6-001; intron 7
ENSMUST00000088483 ; Gpc6-004; intron 8
ENSMUST00000125435 ; Gpc6-002; intron 8
Database links

Mature sequence mmu-miR-6239

Accession MIMAT0024860
Sequence

61 - 

uagcguuggaucacucggug

 - 80

Get sequence
Deep sequencing3370 reads, 87 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1