Stem-loop sequence rno-mir-378b

AccessionMI0021540 (change log)
DescriptionRattus norvegicus miR-378b stem-loop
Literature search

26 open access papers mention rno-mir-378b
(112 sentences)

Stem-loop
   a   gaaca     c   ga     --aa         -   acu 
5'  gga     gugga uug  gucag    ggucugugu gga   g
    |||     ||||| |||  |||||    ||||||||| |||    
3'  ccu     uaccu agu  caguc    ucagguaca ccu   g
   g   -----     u   ac     acua         g   ccg 
Get sequence
Deep sequencing
12752799 reads, 1.02e+04 reads per million, 508 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 5575616-5575699 [-]
intergenic
Database links

Mature sequence rno-miR-378b

Accession MIMAT0024855
Sequence

9 - 

aguggacuuggagucagaagg

 - 29

Get sequence
Deep sequencing12752795 reads, 508 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22470567 "Discovery of novel microRNAs in rat kidney using next generation sequencing and microarray validation" Meng F, Hackenberg M, Li Z, Yan J, Chen T PLoS One. 7:e34394(2012).