Stem-loop sequence hbr-MIR396a

AccessionMI0021481 (change log)
DescriptionHevea brasiliensis miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention hbr-MIR396a
(16 sentences)

Stem-loop
                 a     ---u   -        uuuu     c 
5' cacagcuuucuuga cuuuc    ugu acuuauuc    gaucu u
   |||||||||||||| |||||    ||| ||||||||    |||||  
3' gugucgaaagaacu gaagg    acg uggauaag    uuaga a
                 c     uucc   a        ----     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Hevbra_1.0; GCA_000340545.1) Overlapping transcripts
AJJZ010461223.1: 797-882 [-]
intergenic
Database links

Mature sequence hbr-miR396a

Accession MIMAT0024791
Sequence

1 - 

cacagcuuucuugaacuuucu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22407387 "Genome-wide analysis of microRNAs in rubber tree (Hevea brasiliensis L.) using high-throughput sequencing" Lertpanyasampatha M, Gao L, Kongsawadworakul P, Viboonjun U, Chrestin H, Liu R, Chen X, Narangajavana J Planta. 236:437-445(2012).