Stem-loop sequence nta-MIR6161c

AccessionMI0021468 (change log)
DescriptionNicotiana tabacum miR6161c stem-loop
Gene family MIPF0001465; MIR6161
Stem-loop
   --ca             a     -     g    c 
5'     uccagcauaauau cugga guucg ugca c
       ||||||||||||| ||||| ||||| ||||  
3'     aggucguauuaua gaccu caagu augu u
   ggcc             c     u     -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6161c

Accession MIMAT0024778
Sequence

11 - 

aauauacuggaguucggugcaccu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).