Stem-loop sequence nta-MIR482d

AccessionMI0021466 (change log)
DescriptionNicotiana tabacum miR482d stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention nta-MIR482d
(4 sentences)

Stem-loop
   --       gu   gg       c  -            ucuuuacu      g 
5'   gggagcu  ugg  ugggggg gu gggaagauguca        uuuccu c
     |||||||  |||  ||||||| || ||||||||||||        ||||||  
3'   ccuucgg  acc  acccccc ca cccuucuacggu        agagga g
   aa       uc   au       u  g            -------u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR482d

Accession MIMAT0024776
Sequence

69 - 

uucccgacuccccccauaccac

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).