Stem-loop sequence nta-MIR6161d

AccessionMI0021463 (change log)
DescriptionNicotiana tabacum miR6161d stem-loop
Literature search

1 open access papers mention nta-MIR6161d
(1 sentences)

Stem-loop
   --uaaguaugc ug        c            aguucca    gu 
5'            u  aacuccag auauuauacugg       gcaa  a
              |  |||||||| ||||||||||||       ||||  u
3'            g  uugagguc uauaauaugauc       uguu  a
   cguaaccacaa gu        a            -------    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6161d

Accession MIMAT0024773
Sequence

11 - 

ugaacuccagcauauuauacu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).