Stem-loop sequence nta-MIR6159

AccessionMI0021459 (change log)
DescriptionNicotiana tabacum miR6159 stem-loop
Stem-loop
   -      a      -            g  a    acuuggaguuacaucu 
5'  aacgag aauagg gcgagaauucua gc aaug                a
    |||||| |||||| |||||||||||| || ||||                u
3'  uuguuc uuaucc cgcucuuaagau cg uuac                c
   c      c      a            a  a    gggaaguuaaccagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6159

Accession MIMAT0024769
Sequence

72 - 

uagcauagaauucucgcaccua

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).