Stem-loop sequence nta-MIR6145e

AccessionMI0021455 (change log)
DescriptionNicotiana tabacum miR6145e stem-loop
Gene family MIPF0001620; MIR6145
Literature search

1 open access papers mention nta-MIR6145e
(2 sentences)

Stem-loop
   guaau     -------          u     u    c cauaa 
5'      gagca       uuguuacaug agcac ggcu g     a
        |||||       |||||||||| ||||| |||| |      
3'      cucgu       aacaguguac ucgug ccga c     u
   ----g     uuccccu          -     c    c auuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6145e

Accession MIMAT0024765
Sequence

10 - 

auuguuacauguagcacuggc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).