Stem-loop sequence nta-MIR6145d

AccessionMI0021454 (change log)
DescriptionNicotiana tabacum miR6145d stem-loop
Gene family MIPF0001620; MIR6145
Stem-loop
   --u  ua    u          g           ugcauaa 
5'    gc  gagg auuguuacau uaacacuggcu       g
      ||  |||| |||||||||| |||||||||||        
3'    cg  uucc uaacaaugug auugugaccgg       g
   guc  gc    c          -           cuuuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6145d

Accession MIMAT0024764
Sequence

11 - 

auuguuacauguaacacuggc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).