Stem-loop sequence nta-MIR6148a

AccessionMI0021427 (change log)
DescriptionNicotiana tabacum miR6148a stem-loop
Stem-loop
   -ac        u                  u 
5'    cuagaacc acgucgaucgauuguucu a
      |||||||| |||||||||||||||||| a
3'    gguuuugg ugcaguuaguuaacaaga c
   cuu        u                  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6148a

Accession MIMAT0024737
Sequence

11 - 

uacgucgaucgauuguucuua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).