![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence nta-MIR6148a |
|
Accession | MI0021427 (change log) |
Description | Nicotiana tabacum miR6148a stem-loop |
Stem-loop |
-ac u u 5' cuagaacc acgucgaucgauuguucu a |||||||| |||||||||||||||||| a 3' gguuuugg ugcaguuaguuaacaaga c cuu u a |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence nta-miR6148a |
|
Accession | MIMAT0024737 |
Sequence |
11 - uacgucgaucgauuguucuua - 31 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22353177
"Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)"
BMC Plant Biol. 12:28(2012).
|