Stem-loop sequence nta-MIR6025d

AccessionMI0021422 (change log)
DescriptionNicotiana tabacum miR6025d stem-loop
Gene family MIPF0001375; MIR6025
Stem-loop
   --cug    a      a                  u       -     aa    uuauccu 
5'      gcau ccaaca uugagauaacaucuaggu ugacgau cuuuu  guaa       a
        |||| |||||| |||||||||||||||||| ||||||| |||||  ||||       c
3'      cgua gguugu gacucuauuguaggucca gcuguua gaaaa  cguu       g
   gaaua    c      -                  u       u     ca    cuuaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6025d

Accession MIMAT0024732
Sequence

11 - 

aacaauugagauaacaucuagg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).