Stem-loop sequence nta-MIR482c

AccessionMI0021417 (change log)
DescriptionNicotiana tabacum miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention nta-MIR482c
(3 sentences)

Stem-loop
   --               u      -         u   cccu  u 
5'   gaaaacuauggggau gguggg uuggaaagc uuu    uc g
     ||||||||||||||| |||||| ||||||||| |||    || a
3'   uuuuugguauccuua ccaccu aaccuuucg aaa    ag u
   ac               c      u         c   --uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR482c

Accession MIMAT0024727
Sequence

57 - 

uuuccaauuccacccauuccua

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).