Stem-loop sequence nta-MIR1919

AccessionMI0021416 (change log)
DescriptionNicotiana tabacum miR1919 stem-loop
Gene family MIPF0000582; MIR1919
Literature search

1 open access papers mention nta-MIR1919
(2 sentences)

Stem-loop
   ---   gugc                uu    c   c  -   -  c         --ucaauuu   a    gaaau 
5'    ccg    uccugucgcagaugac  ucgc cuu uc uac aa gacccuuca         aca ugaa     c
      |||    ||||||||||||||||  |||| ||| || ||| || |||||||||         ||| ||||      
3'    ggu    aggacagugucuacug  agcg gaa ag gug uu uugggaggu         ugu acuu     a
   gaa   -aau                --    a   c  u   a  u         ucaucuuuu   g    aauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR1919

Accession MIMAT0024726
Sequence

118 - 

gagcgagucaucugugacagg

 - 138

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).