Stem-loop sequence nta-MIR827

AccessionMI0021415 (change log)
DescriptionNicotiana tabacum miR827 stem-loop
Gene family MIPF0000726; MIR827
Literature search

1 open access papers mention nta-MIR827
(1 sentences)

Stem-loop
   --u     uu            g       uucaucauucugcauaguu 
5'    augaa  uguuuguugaug ucaucua                   u
      |||||  |||||||||||| |||||||                   u
3'    uacuu  acaaacaacuac aguagau                   u
   cac     cu            a       ugguauccuauuacccacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR827

Accession MIMAT0024725
Sequence

69 - 

uuagaugaacaucaacaaaca

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).