Stem-loop sequence nta-MIR479a

AccessionMI0021413 (change log)
DescriptionNicotiana tabacum miR479a stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

1 open access papers mention nta-MIR479a
(3 sentences)

Stem-loop
   --u  g   u  c                      -    ---     gaau 
5'    ca aca gg gugauauugguuuggcucauca cuuu   cuguu    u
      || ||| || |||||||||||||||||||||| ||||   |||||     
3'    gu ugu uc cacuauaaccaggccgaguagu gaga   gacag    c
   uuc  a   -  u                      a    ucu     agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR479a

Accession MIMAT0024723
Sequence

11 - 

cgugauauugguuuggcucauc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).