Stem-loop sequence nta-MIR477b

AccessionMI0021412 (change log)
DescriptionNicotiana tabacum miR477b stem-loop
Literature search

2 open access papers mention nta-MIR477b
(5 sentences)

Stem-loop
   --cacug           uc   -           c    gcuuguucauaagauuuauaagcuuuu 
5'        cuuguugucuc  ccu caagggcuucu uucu                           a
          |||||||||||  ||| ||||||||||| ||||                            
3'        gaacaacagag  gga guucucgagga aagg                           a
   ccguaaa           uu   c           u    gucauacgaaauucaaaucguagaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR477b

Accession MIMAT0024722
Sequence

13 - 

ucucucccucaagggcuucuc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).