Stem-loop sequence nta-MIR408

AccessionMI0021410 (change log)
DescriptionNicotiana tabacum miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

3 open access papers mention nta-MIR408
(7 sentences)

Stem-loop
   --ga     u  a      c       a     ag   u    uu 
5'     gagga ag caggga gagguag gcaug  aug gcaa  u
       ||||| || |||||| ||||||| |||||  ||| ||||  u
3'     cuccu uc gucccu cuccguc cguau  uac cguu  u
   cucc     c  g      u       a     cu   c    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR408

Accession MIMAT0024720
Sequence

61 - 

ugcacugccucuucccuggcu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).