Stem-loop sequence nta-MIR399g

AccessionMI0021409 (change log)
DescriptionNicotiana tabacum miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention nta-MIR399g
(11 sentences)

Stem-loop
   --a             ua      a     a  -     -  u  u 
5'    auagugauagggc  cucucu uuggc ug caguu aa ua a
      |||||||||||||  |||||| ||||| || ||||| || ||  
3'    ugucauugucccg  gagagg aaccg ac gucga uu au u
   cuc             uc      a     c  a     c  u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR399g

Accession MIMAT0024719
Sequence

60 - 

cgccaaaggagagcugcccug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).