Stem-loop sequence nta-MIR399f

AccessionMI0021408 (change log)
DescriptionNicotiana tabacum miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention nta-MIR399f
(11 sentences)

Stem-loop
   --a     gg      ua      a     a  -     -  u       -ac   cucu 
5'    auagu  uagggc  cucucu uuggc ug caguu aa uauguau   uga    u
      |||||  ||||||  |||||| ||||| || ||||| || |||||||   |||     
3'    uguca  gucccg  gagagg aaccg ac gucga uu auauaua   gcu    a
   cuc     uu      uc      a     c  a     c  u       cac   acua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR399f

Accession MIMAT0024718
Sequence

87 - 

cgccaaaggagagcugcccug

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).