Stem-loop sequence nta-MIR399d

AccessionMI0021406 (change log)
DescriptionNicotiana tabacum miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention nta-MIR399d
(11 sentences)

Stem-loop
   --a     gg      ua      a     a  -  -  u  u       a     ucca 
5'    auagu  uagggc  cucucu uuggc ug ca cu aa uauguau gugau    c
      |||||  ||||||  |||||| ||||| || || || || ||||||| |||||    u
3'    uauca  gucccg  gagagg aaccg ac gu ga uu auauaua cacua    u
   cuc     uu      uc      a     c  a  u  c  c       -     cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR399d

Accession MIMAT0024716
Sequence

88 - 

cgccaaaggagagcugcccug

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).