Stem-loop sequence nta-MIR399b

AccessionMI0021404 (change log)
DescriptionNicotiana tabacum miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention nta-MIR399b
(11 sentences)

Stem-loop
   --a             ua      a     a  -      -ua     a    cu 
5'    acagugauagggc  cucucu uuggc ug caguua   uaugu guga  c
      |||||||||||||  |||||| ||||| || ||||||   ||||| ||||  c
3'    ugucauugucccg  gagagg aaccg ac gucgau   auaua uacu  a
   cuc             uc      a     c  a      uua     a    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR399b

Accession MIMAT0024714
Sequence

79 - 

cgccaaaggagagcugcccug

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).