Stem-loop sequence nta-MIR399a

AccessionMI0021403 (change log)
DescriptionNicotiana tabacum miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention nta-MIR399a
(14 sentences)

Stem-loop
   --a     gg      ua      a     a  - c   ---  a     u    c 
5'    acagu  uagggc  cucucu uuggc ug c guu   au uguau guga u
      |||||  ||||||  |||||| ||||| || | |||   || ||||| |||| c
3'    uguca  gucccg  gagagg aaccg ac g cga   ua auaua cacu c
   cuc     uu      uc      a     c  a u   cuu  a     -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR399a

Accession MIMAT0024713
Sequence

78 - 

cgccaaaggagagcugcccug

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).