Stem-loop sequence nta-MIR398

AccessionMI0021402 (change log)
DescriptionNicotiana tabacum miR398 stem-loop
Gene family MIPF0000107; MIR398
Literature search

6 open access papers mention nta-MIR398
(20 sentences)

Stem-loop
   --ug  a        a        u         guacuuuucuuuuuucucugua 
5'     uc acaggggc aucugaga cacauguug                      a
       || |||||||| |||||||| |||||||||                      a
3'     ag uguccccg uggacucu guguauaac                      u
   aucg  a        c        u         ucuauaacuuuggugugaacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR398

Accession MIMAT0024712
Sequence

85 - 

uguguucucaggucgccccug

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).