Stem-loop sequence nta-MIR397

AccessionMI0021401 (change log)
DescriptionNicotiana tabacum miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

3 open access papers mention nta-MIR397
(10 sentences)

Stem-loop
   -         c              u    u    uucugu   gucuuu  uu     uuug 
5'  uagaaacau auugagugcagcgu gaug caau      gaa      aa  uggca    g
    ||||||||| |||||||||||||| |||| ||||      |||      ||  |||||    u
3'  auuuuugua uaacucacgucgcg cuac guug      cuu      uu  accgu    c
   g         c              u    u    ------   aaccuu  uc     uuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR397

Accession MIMAT0024711
Sequence

11 - 

auugagugcagcguugaugu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).