Stem-loop sequence nta-MIR396a

AccessionMI0021398 (change log)
DescriptionNicotiana tabacum miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention nta-MIR396a
(17 sentences)

Stem-loop
   ---c                     c          -------ua     gaaaac    -a   uau    cc 
5'     uuuguauuuuuccacagcuuu uugaacugca         uauuu      ucac  cca   auaa  a
       ||||||||||||||||||||| ||||||||||         |||||      ||||  |||   ||||  a
3'     agacauagaagggugucggaa aacuuggcgu         auaaa      agug  ggu   uauu  u
   ugau                     u          uguuaaaaa     -auaaa    ga   uau    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR396a

Accession MIMAT0024708
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).