Stem-loop sequence nta-MIR395c

AccessionMI0021397 (change log)
DescriptionNicotiana tabacum miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention nta-MIR395c
(46 sentences)

Stem-loop
   ----     cua         ug u       u    ---acuucaaa         aaa 
5'     uuccc   gaguucucc  a cacuuca uggg           aaugcccuu   a
       |||||   |||||||||  | ||||||| ||||           |||||||||    
3'     gaggg   cucaagggg  u gugaagu aucc           uuaugggaa   u
   cacc     --c         gu u       c    guaauuauuaa         agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR395c

Accession MIMAT0024707
Sequence

83 - 

cugaaguguuugggggaacuc

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).