Stem-loop sequence nta-MIR395b

AccessionMI0021396 (change log)
DescriptionNicotiana tabacum miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention nta-MIR395b
(49 sentences)

Stem-loop
   --uucc   u         ug u       uugggacuugaaaaaugcccuuaaau 
5'       ccu gaguucucc  a cacuuca                          u
         ||| |||||||||  | |||||||                           
3'       gga cucaagggg  u gugaagu                          g
   caccga   u         gu u       cauccguaauuauuaauuaugguaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR395b

Accession MIMAT0024706
Sequence

82 - 

cugaaguguuugggggaacuc

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).